Top » Catalog » SNPs » FGC53427

$18.00

FGC53427
[FGC53427]

FGC53427
hg38 Position: ChrY:19392258..19392258
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U152 > L2 > FGC22538 > FGC22516
Forward Primer: FGC53427_F GGGACAGTTTGACTCCCACTC
Reverse Primer: FGC53427_R ATTTTATGCCAGGGATGCAG
Reviews

Customers who bought this product also purchased
FGC66925
FGC66925
A11972
A11972
FGC66921
FGC66921
A11966
A11966
FGC53415
FGC53415
A11965
A11965
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x WGS400
$399.00
Haplogroup Info
Other products
Currencies