Top » Catalog » SNPs » FGC53427

$18.00

FGC53427
[FGC53427]

FGC53427
hg38 Position: ChrY:19392258..19392258
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U152 > L2 > FGC22538 > FGC22516
Forward Primer: FGC53427_F GGGACAGTTTGACTCCCACTC
Reverse Primer: FGC53427_R ATTTTATGCCAGGGATGCAG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies