Top » Catalog » SNPs » Y16494

$18.00

Y16494
[Y16494]

Y16494
HG19 Position: ChrY:8203613..8203613
Ancestral: A
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Below Z93 > Y9 > Y30 > Y944 > Y2428
Forward Primer: Y16494_F GTGCTTGATGACCATGTTGG
Reverse Primer: Y16494_R TCCATGGTTCCCAGAAGAAG
Reviews

Customers who bought this product also purchased
DYS487
DYS487
DYF406S1
DYF406S1
DYS492
DYS492
DYS565
DYS565
DYS640
DYS640
DYS572
DYS572
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies