Top » Catalog » SNPs » Y16494

$18.00

Y16494
[Y16494]

Y16494
HG19 Position: ChrY:8203613..8203613
Ancestral: A
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Below Z93 > Y9 > Y30 > Y944 > Y2428
Forward Primer: Y16494_F GTGCTTGATGACCATGTTGG
Reverse Primer: Y16494_R TCCATGGTTCCCAGAAGAAG
Reviews

Customers who bought this product also purchased
DYS522
DYS522
DYS617
DYS617
YSEQ-Gamma
YSEQ-Gamma
DYS568
DYS568
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
DYS487
DYS487
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies