Top » Catalog » SNPs » FGC4

$18.00

FGC4
[FGC4]

FGC4
hg38 Position: ChrY:7671796..7671796
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC3
Forward Primer: FGC4_F ACCAACATGTTTCTTTTAGTAACACG
Reverse Primer: FGC4_R CACCTGCACGAGGGCTTC
Reviews

Customers who bought this product also purchased
FGC5424
FGC5424
ZS8984
ZS8984
ZS3912
ZS3912
FGC4474
FGC4474
FGC41256
FGC41256
FGC5441
FGC5441
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies