Top » Catalog » SNPs » FGC4

$18.00

FGC4
[FGC4]

FGC4
hg38 Position: ChrY:7671796..7671796
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC3
Forward Primer: FGC4_F ACCAACATGTTTCTTTTAGTAACACG
Reverse Primer: FGC4_R CACCTGCACGAGGGCTTC
Reviews

Customers who bought this product also purchased
FGC5424
FGC5424
FGC29811
FGC29811
ZS12072
ZS12072
J1-M267 Superclade Panel
J1-M267 Superclade Panel
ZS7564
ZS7564
Z18219
Z18219
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ZS9124
1 x ZS7155
1 x ZS7702
1 x ZS9923
1 x ZS8368
1 x ZS9657
1 x ZW04
$126.00
Haplogroup Info
Other products
Currencies