Top » Catalog » SNPs » FGC4

$18.00

FGC4
[FGC4]

FGC4
HG19 Position: ChrY:7539837..7539837
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC3
Comments: Downstream of J1-FGC3
Forward Primer: FGC4_F ACCAACATGTTTCTTTTAGTAACACG
Reverse Primer: FGC4_R CACCTGCACGAGGGCTTC
Reviews

Customers who bought this product also purchased
FGC5424
FGC5424
FGC29811
FGC29811
ZS12072
ZS12072
J1-M267 Superclade Panel
J1-M267 Superclade Panel
ZS7564
ZS7564
Z18219
Z18219
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies