Top » Catalog » SNPs » FGC4

$18.00

FGC4
[FGC4]

FGC4
HG19 Position: ChrY:7539837..7539837
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC3
Comments: Downstream of J1-FGC3
Forward Primer: FGC4_F ACCAACATGTTTCTTTTAGTAACACG
Reverse Primer: FGC4_R CACCTGCACGAGGGCTTC
Reviews

Customers who bought this product also purchased
FGC5424
FGC5424
Z18219
Z18219
ZS9904
ZS9904
ZS5613
ZS5613
ZS12043
ZS12043
FGC4480
FGC4480
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies