Top » Catalog » SNPs » FGC4417

$18.00

FGC4417
[FGC4417]

FGC4417
HG19 Position: ChrY:14501986..14501986
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC12
Comments: Downstream of J1-FGC12
Forward Primer: FGC4417_F ATTACCTGGGTGTGGTGGTG
Reverse Primer: FGC4417_R ATTCCAGGTTTTCACGATGG
Reviews

Customers who bought this product also purchased
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC4430
FGC4430
FGC4429
FGC4429
ZS8303
ZS8303
FGC4708
FGC4708
ZS9296
ZS9296
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies