Top » Catalog » SNPs » FGC4417

$18.00

FGC4417
[FGC4417]

FGC4417
hg38 Position: ChrY:12390191..12390191
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC12
Comments: Downstream of J1-FGC12
Forward Primer: FGC4417_F ATTACCTGGGTGTGGTGGTG
Reverse Primer: FGC4417_R ATTCCAGGTTTTCACGATGG
Reviews

Customers who bought this product also purchased
FGC5
FGC5
FGC4423
FGC4423
BY4
BY4
BY8
BY8
FGC1695
FGC1695
FGC1707
FGC1707
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies