Top » Catalog » SNPs » FGC4417

$18.00

FGC4417
[FGC4417]

FGC4417
HG19 Position: ChrY:14501986..14501986
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC12
Comments: Downstream of J1-FGC12
Forward Primer: FGC4417_F ATTACCTGGGTGTGGTGGTG
Reverse Primer: FGC4417_R ATTCCAGGTTTTCACGATGG
Reviews

Customers who bought this product also purchased
FGC4429
FGC4429
ZS8303
ZS8303
FGC4708
FGC4708
ZS9296
ZS9296
FGC4411
FGC4411
ZS10545
ZS10545
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies