Top » Catalog » SNPs » FGC4417

$18.00

FGC4417
[FGC4417]

FGC4417
hg38 Position: ChrY:12390191..12390191
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC12
Comments: Downstream of J1-FGC12
Forward Primer: FGC4417_F ATTACCTGGGTGTGGTGGTG
Reverse Primer: FGC4417_R ATTCCAGGTTTTCACGATGG
Reviews

Customers who bought this product also purchased
ZS8853
ZS8853
ZS10297
ZS10297
FGC4421
FGC4421
FGC11
FGC11
A18075
A18075
ZS11156
ZS11156
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies