Top » Catalog » SNPs » FGC4421

$18.00

FGC4421
[FGC4421]

FGC4421
hg38 Position: ChrY:13513253..13513253
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC12
Comments: Downstream of J1-FGC12
Forward Primer: FGC4421_F GCCCATACCAGGTTTCTGAC
Reverse Primer: FGC4421_R CTCTGGAGACTGGCCTGAAC
Reviews

Customers who bought this product also purchased
BY43465
BY43465
BY178288
BY178288
Y153573
Y153573
ZS9287
ZS9287
ZS9621
ZS9621
ZS10065
ZS10065
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies