Top » Catalog » SNPs » FGC4421

$18.00

FGC4421
[FGC4421]

FGC4421
hg38 Position: ChrY:13513253..13513253
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC12
Comments: Downstream of J1-FGC12
Forward Primer: FGC4421_F GCCCATACCAGGTTTCTGAC
Reverse Primer: FGC4421_R CTCTGGAGACTGGCCTGAAC
Reviews

Customers who bought this product also purchased
FGC4402
FGC4402
FT67308
FT67308
ZS10418
ZS10418
MF10702
MF10702
ZS10419
ZS10419
ZS10622
ZS10622
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies