Top » Catalog » SNPs » FGC4422

$18.00

FGC4422
[FGC4422]

FGC4422
hg38 Position: ChrY:14458796..14458796
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC12
Comments: Downstream of J1-FGC12
Forward Primer: FGC4422_F TGGCAGCATTTCATACTTGC
Reverse Primer: FGC4422_R TGCAAAATTCTGCTTTCCTG
Reviews

Customers who bought this product also purchased
M96
M96
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
FT49600
FT49600
M10667
M10667
ZS9200
ZS9200
BY16791
BY16791
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies