Top » Catalog » SNPs » FGC6

$18.00

FGC6
[FGC6]

FGC6
hg38 Position: ChrY:3666664..3666664
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC1696
Forward Primer: FGC6_F CCATCTCTTGCATCAGAATGAG
Reverse Primer: FGC6_R ATCATATGGCAGCTGTACTTTTATTG
Reviews

Customers who bought this product also purchased
DYS607
DYS607
CDY
CDY
DYS390
DYS390
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
DYS713
DYS713
DYR76
DYR76
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies