Top » Catalog » SNPs » FGC6

$18.00

FGC6
[FGC6]

FGC6
hg38 Position: ChrY:3666664..3666664
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC1696
Forward Primer: FGC6_F CCATCTCTTGCATCAGAATGAG
Reverse Primer: FGC6_R ATCATATGGCAGCTGTACTTTTATTG
Reviews

Customers who bought this product also purchased
FGC4316
FGC4316
FGC1696
FGC1696
ZS11060
ZS11060
ZS4756
ZS4756
ZS4753
ZS4753
FGC38809
FGC38809
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies