Top » Catalog » SNPs » FGC6

$15.00

FGC6
[FGC6]

FGC6
hg38 Position: ChrY:3666664..3666664
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC1696
Forward Primer: FGC6_F CCATCTCTTGCATCAGAATGAG
Reverse Primer: FGC6_R ATCATATGGCAGCTGTACTTTTATTG
Reviews

Customers who bought this product also purchased
ZS4003
ZS4003
Y82304
Y82304
FGC4320
FGC4320
Y100310
Y100310
FGC4371
FGC4371
ZS11919
ZS11919
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies