Top » Catalog » SNPs » FGC6

$18.00

FGC6
[FGC6]

FGC6
hg38 Position: ChrY:3666664..3666664
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC1696
Forward Primer: FGC6_F CCATCTCTTGCATCAGAATGAG
Reverse Primer: FGC6_R ATCATATGGCAGCTGTACTTTTATTG
Reviews

Customers who bought this product also purchased
ZS4760
ZS4760
ZS4757
ZS4757
FGC7944
FGC7944
ZS9483
ZS9483
FGC1695
FGC1695
FGC51963
FGC51963
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies