Top » Catalog » SNPs » FTA81329

$19.00

FTA81329
[FTA81329]

FTA81329
hg38 Position: ChrY:13402533..13402533
Ancestral: C
Derived: G
Reference: FTDNA (2021)
ISOGG Haplogroup: E
Comments: Below V65 > Z1231 > CTS194
Forward Primer: FTA81329_F CCCCCAAACAGCATAAAATG
Reverse Primer: FTA81329_R TGCTGAGGCAGACAACAAAC
Reviews

Customers who bought this product also purchased
L335
L335
Y49204
Y49204
BY148790
BY148790
M215
M215
V22
V22
Y293069
Y293069
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies