Top » Catalog » SNPs » FTA81329

$19.00

FTA81329
[FTA81329]

FTA81329
hg38 Position: ChrY:13402533..13402533
Ancestral: C
Derived: G
Reference: FTDNA (2021)
ISOGG Haplogroup: E
Comments: Below V65 > Z1231 > CTS194
Forward Primer: FTA81329_F CCCCCAAACAGCATAAAATG
Reverse Primer: FTA81329_R TGCTGAGGCAGACAACAAAC
Reviews

Customers who bought this product also purchased
M267
M267
Y96535
Y96535
Z834
Z834
M5247
M5247
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
BY8789
BY8789
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies