Top » Catalog » SNPs » FGC7448

$18.00

FGC7448
[FGC7448]

FGC7448
hg38 Position: ChrY:8633018..8633018
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1~
Comments: Found in a R-DF13 person and PGP50
Forward Primer: FGC7448v2_F GCACTAGTCTCAGGGAACCAGTCT
Reverse Primer: FGC7448v2_R AACACTCACCGCTACGATGTG
Reviews

Customers who bought this product also purchased
S1090
S1090
BY203693
BY203693
S1105
S1105
A194
A194
Z251
Z251
DF41
DF41
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies