Top » Catalog » SNPs » A12373

$18.00

A12373
[A12373]

A12373
hg38 Position: ChrY:12980011..12980011
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2 (not listed)
Comments: Below PF4189
Forward Primer: A12373_F AAGAAGGAAATCCTGCCATATG
Reverse Primer: A12373_R TTCAGCCTGGGCAACAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies