Top » Catalog » SNPs » Z1936

$18.00

Z1936
[Z1936]

Z1936
hg38 Position: ChrY:19301440..19301440
Ancestral: C
Derived: T
Reference: Ray Banks (2012)
ISOGG Haplogroup: N1a1a1a1a2
Comments: Downstream from N-M178
Forward Primer: Z1936_F TTTTGAACACTTTTTGCATTTC
Reverse Primer: Z1936_R GATAGCCAGGTACAAGGTTTGG
Reviews

Customers who bought this product also purchased
VL60
VL60
VL72
VL72
Y17790
Y17790
Y28538
Y28538
L1034
L1034
Z1930
Z1930
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies