Top » Catalog » SNPs » Z1936

$18.00

Z1936
[Z1936]

Z1936
hg38 Position: ChrY:19301440..19301440
Ancestral: C
Derived: T
Reference: Ray Banks (2012)
ISOGG Haplogroup: N1a1a1a1a2
Comments: Downstream from N-M178
Forward Primer: Z1936_F TTTTGAACACTTTTTGCATTTC
Reverse Primer: Z1936_R GATAGCCAGGTACAAGGTTTGG
Reviews

Customers who bought this product also purchased
MF14557
MF14557
Y19455
Y19455
Y13851
Y13851
Y19453
Y19453
FT25036
FT25036
Z34986
Z34986
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies