Top » Catalog » SNPs » A12377

$18.00

A12377
[A12377]

A12377
hg38 Position: ChrY:8711265..8711265
Ancestral: A
Derived: G
Reference: Judith Simon (2016)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A12377_F GTGGTACAGCCAAACCCATC
Reverse Primer: A12377_R ACTTGCCATTGTCCTGGTTC
Reviews

Customers who bought this product also purchased
M267
M267
A12379
A12379
A12378
A12378
A12376
A12376
A12375
A12375
A12380
A12380
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies