Top » Catalog » SNPs » A12386

$18.00

A12386
[A12386]

A12386
hg38 Position: ChrY:9601368..9601368
Ancestral: A
Derived: T
Reference: James Kane (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A12386_F AGGCCATGAAGTTCAATATCAATG
Reverse Primer: A12386_R GCCTTCATATAGCTTCCAACTCAAG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies