Top » Catalog » SNPs » A12386

$18.00

A12386
[A12386]

A12386
hg38 Position: ChrY:9601368..9601368
Ancestral: A
Derived: T
Reference: James Kane (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A12386_F AGGCCATGAAGTTCAATATCAATG
Reverse Primer: A12386_R GCCTTCATATAGCTTCCAACTCAAG
Reviews

Customers who bought this product also purchased
DF21
DF21
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
A286
A286
Z253
Z253
FGC5494
FGC5494
FGC11293
FGC11293
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies