Top » Catalog » SNPs » A12386

$18.00

A12386
[A12386]

A12386
HG19 Position: ChrY:9601368..9601368
Ancestral: A
Derived: T
Reference: James Kane (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A12386_F AGGCCATGAAGTTCAATATCAATG
Reverse Primer: A12386_R GCCTTCATATAGCTTCCAACTCAAG
Reviews

Customers who bought this product also purchased
DF49
DF49
BY23383
BY23383
FGC11134
FGC11134
A353
A353
DF13
DF13
FGC11304
FGC11304
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies