Top » Catalog » SNPs » ZS1820

$19.00

ZS1820
[ZS1820]

ZS1820
hg38 Position: ChrY:7197833..7197833
Ancestral: G
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y sample M7040; approximate to CTS9501 aka FGC14704
Forward Primer: ZS1820_F CTAGCTGGAACCCCAATGAG
Reverse Primer: ZS1820_R CCAACAGATCAGCCTTCTCC
Reviews

Customers who bought this product also purchased
BY145
BY145
FT360947
FT360947
FGC1723
FGC1723
Y146404
Y146404
FGC7379
FGC7379
FT79795
FT79795
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies