Top » Catalog » SNPs » FGC5505

$18.00

FGC5505
[FGC5505]

FGC5505
hg38 Position: ChrY:5988880..5988880
Ancestral: C
Derived: A
Reference: Full Genomes Inc (2013)
ISOGG Haplogroup: R1b (not listed)
Comments: Found in a R-DF13 person
Forward Primer: FGC5505_F TTCTATGCTGCTATATCAAATTACTAAGAAG
Reverse Primer: FGC5505_R CCTGGATTAGCTATGTGGATCC
Reviews

Customers who bought this product also purchased
FGC5533
FGC5533
FGC5541
FGC5541
FGC5508
FGC5508
FGC5554
FGC5554
FGC5530
FGC5530
FGC5539
FGC5539
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies