Top » Catalog » SNPs » BY3506

$18.00

BY3506
[BY3506]

BY3506
hg38 Position: ChrY:7415607..7415607
Ancestral: T
Derived: C
Reference: FTDNA (2016)
ISOGG Haplogroup: R1b
Comments: Downstream BY3508
Forward Primer: BY3506v2_F TCAGACAAGGGCATCTATCTGAG
Reverse Primer: BY3506v2_R GTTAGATGAGCAAAAGCCCAG
Reviews

Customers who bought this product also purchased
BY3301
BY3301
YP6098
YP6098
HVR1
HVR1
YP3929
YP3929
YP613
YP613
YP4286
YP4286
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies