Top » Catalog » SNPs » PF6582

$15.00

PF6582
[PF6582]

PF6582
hg38 Position: ChrY:20564866..20564866
Ancestral: C
Derived: T
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: R1b
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF6582_F ATGCAGAAGACCCCAGAAAG
Reverse Primer: PF6582_R ATGGTGTCCCTGTTGTGTTC
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
P312
P312
U152
U152
L513
L513
L21
L21
Z367
Z367
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies