Top » Catalog » SNPs » PF6582

$18.00

PF6582
[PF6582]

PF6582
HG19 Position: ChrY:20564866..20564866
Ancestral: C
Derived: T
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: R1b
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF6582_F ATGCAGAAGACCCCAGAAAG
Reverse Primer: PF6582_R ATGGTGTCCCTGTTGTGTTC
Reviews

Customers who bought this product also purchased
U152
U152
L513
L513
L21
L21
Z367
Z367
DYS390
DYS390
Z68
Z68
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies