Top » Catalog » SNPs » PF6582

$18.00

PF6582
[PF6582]

PF6582
hg38 Position: ChrY:20564866..20564866
Ancestral: C
Derived: T
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: R1b
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF6582_F ATGCAGAAGACCCCAGAAAG
Reverse Primer: PF6582_R ATGGTGTCCCTGTTGTGTTC
Reviews

Customers who bought this product also purchased
S1527
S1527
FGC37197
FGC37197
S1523
S1523
FGC37210
FGC37210
FGC37214
FGC37214
BY3953
BY3953
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies