Top » Catalog » SNPs » Y17172

$18.00

Y17172
[Y17172]

Y17172
HG19 Position: ChrY:20602689..20602689
Ancestral: A
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y17172_F GAACTGACACAAGATAAGGCTGTG
Reverse Primer: Y17172_R TTTCAATGGCCAAACCAATC
Reviews

Customers who bought this product also purchased
Z367
Z367
CTS5531
CTS5531
Y19751
Y19751
Z56
Z56
PH2997
PH2997
Y19716
Y19716
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies