Top » Catalog » SNPs » Y17172

$18.00

Y17172
[Y17172]

Y17172
hg38 Position: ChrY:20602689..20602689
Ancestral: A
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y17172_F GAACTGACACAAGATAAGGCTGTG
Reverse Primer: Y17172_R TTTCAATGGCCAAACCAATC
Reviews

Customers who bought this product also purchased
Y19716
Y19716
Z192
Z192
A7969
A7969
Y16885
Y16885
Z68
Z68
L2
L2
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies