Top » Catalog » SNPs » Y17172

$18.00

Y17172
[Y17172]

Y17172
hg38 Position: ChrY:20602689..20602689
Ancestral: A
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y17172_F GAACTGACACAAGATAAGGCTGTG
Reverse Primer: Y17172_R TTTCAATGGCCAAACCAATC
Reviews

Customers who bought this product also purchased
L2
L2
Y17163
Y17163
R1b-U152 Superclade Panel
R1b-U152 Superclade Panel
U152
U152
S8010
S8010
Z367
Z367
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies