Top » Catalog » SNPs » Y24500

$18.00

Y24500
[Y24500]

Y24500
HG19 Position: ChrY:12388619..12388619
Ancestral: C
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: Y24500_F AAGGGTGTGTTCTCTTCCAAGTAG
Reverse Primer: Y24500_R GTTGTTTCTATGGATAATGGTTGC
Reviews

Customers who bought this product also purchased
L550
L550
Z35267
Z35267
Y5004
Y5004
Y16503
Y16503
N1a-VL29 Panel
N1a-VL29 Panel
Y6599
Y6599
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies