Top » Catalog » SNPs » Y24500

$18.00

Y24500
[Y24500]

Y24500
HG19 Position: ChrY:12388619..12388619
Ancestral: C
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: Y24500_F AAGGGTGTGTTCTCTTCCAAGTAG
Reverse Primer: Y24500_R GTTGTTTCTATGGATAATGGTTGC
Reviews

Customers who bought this product also purchased
Y5005
Y5005
Y18573
Y18573
L550
L550
Z35267
Z35267
Y5004
Y5004
Y16503
Y16503
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies