Top » Catalog » SNPs » A12374

$18.00

A12374
[A12374]

A12374
hg38 Position: ChrY:14519923..14519923
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2 (not listed)
Comments: Below A7729
Forward Primer: A12374_F CCACAAGCATGCACTACCAC
Reverse Primer: A12374_R GATTGCTGTGGGGAGACATC
Reviews

Customers who bought this product also purchased
DYS390
DYS390
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies