Top » Catalog » SNPs » FGC5510

$18.00

FGC5510
[FGC5510]

FGC5510
hg38 Position: ChrY:7943598..7943598
Ancestral: T
Derived: C
Reference: Full Genomes Inc (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1~
Comments: Found in a R-DF13 person
Forward Primer: FGC5510_F CATATGGCACTATTTCACCTGTTG
Reverse Primer: FGC5510_R GGGCATAGGAATAAGGTACTAATATCG
Reviews

Customers who bought this product also purchased
FGC5534
FGC5534
FGC5543
FGC5543
FGC5521
FGC5521
FGC5533
FGC5533
FGC5541
FGC5541
FGC5508
FGC5508
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies