Top » Catalog » SNPs » A12472

$18.00

A12472
[A12472]

A12472
hg38 Position: ChrY:2901725..2901725
Ancestral: G
Derived: C
Reference: Timothy Schrag (2016)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A12472_F AATTATATCAAGCACTCTTTCAAACTATG
Reverse Primer: A12472_R GTTCTTGTTTCTCTAGTTCCTTGG
Reviews

Customers who bought this product also purchased
FGC45340
FGC45340
FGC45318
FGC45318
A12473
A12473
Wish a SNP
Wish a SNP
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies