Top » Catalog » SNPs » FGC45340

$18.00

FGC45340
[FGC45340]

FGC45340
hg38 Position: ChrY:16749057..16749057
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J2a
Comments: Below Y20307
Forward Primer: FGC45340_F ATTTGGGGCTGCAATGATAG
Reverse Primer: FGC45340_R GATGCAAGGCTGGTTCAATAC
Reviews

Customers who bought this product also purchased
Y20554
Y20554
J2a-Y20306 Segregation Panel
J2a-Y20306 Segregation Panel
Y20325
Y20325
Y20321
Y20321
Y20575
Y20575
Y20319
Y20319
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies