Top » Catalog » SNPs » A6550

$18.00

A6550
[A6550]

A6550
hg38 Position: ChrY:7901585..7901585
Ancestral: G
Derived: T
Reference: William Hartley (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: Downstream Z138+
Forward Primer: A6550_F CCTTCTCGGCTTCCAAAAG
Reverse Primer: A6550_R TCCTCATCGTGTGAGTATACAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies