Top » Catalog » SNPs » A12499

$18.00

A12499
[A12499]

A12499
hg38 Position: ChrY:14656627..14656627
Ancestral: A
Derived: C
Reference: Timothy Schrag (2016)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A12499_F GCTGGGCAGATTACTTGAGG
Reverse Primer: A12499_R TGCAATGTCCTAGTTTGGAGTG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies