Top » Catalog » SNPs » A12500

$18.00

A12500
[A12500]

A12500
HG19 Position: ChrY:15713880..15713880
Ancestral: T
Derived: G
Reference: Timothy Schrag (2016)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A12500v2_F AGAATGGACTTACTGCCTCCC
Reverse Primer: A12500v2_R AGGAGCTGCGTTCCTTCA
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies