Top » Catalog » SNPs » FGC50114

$18.00

FGC50114
[FGC50114]

FGC50114
HG19 Position: ChrY:7040416..7040416
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J2a
Comments: Below Y20307
Forward Primer: FGC50114_F CTTTATGCTGCGCATTTGTC
Reverse Primer: FGC50114_R AATTCCCTGCATGGACACAG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies