Top » Catalog » SNPs » FGC50115

$18.00

FGC50115
[FGC50115]

FGC50115
hg38 Position: ChrY:9250734..9250734
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: FGC50115_F CCTCTGACTCCTCTTTCCTCCTATAG
Reverse Primer: FGC50115_R GCCACCACGTCTGGGC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies