Top » Catalog » SNPs » FGC50116

$18.00

FGC50116
[FGC50116]

FGC50116
HG19 Position: ChrY:9968184..9968184
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: FGC50116_F CATTTTTGTCCACAGGCATTAC
Reverse Primer: FGC50116_R GCAAATCACGAGGTCAGGAG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies