Top » Catalog » SNPs » FGC50124

$18.00

FGC50124
[FGC50124]

FGC50124
hg38 Position: ChrY:12831108..12831108
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: FGC50124_F GCAAAGTAGCAGAATGCAAAGTC
Reverse Primer: FGC50124_R TTGTTGTGCATTGCCTTTATG
Reviews

Customers who bought this product also purchased
FGC50130
FGC50130
FGC50129
FGC50129
FGC50116
FGC50116
FGC50115
FGC50115
FGC50114
FGC50114
FGC50127
FGC50127
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies