Top » Catalog » SNPs » FGC50126

$18.00

FGC50126
[FGC50126]

FGC50126
HG19 Position: ChrY:13647194..13647194
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: FGC50126vl_F TTCCCACTTATGTATGAGAACGG
Reverse Primer: FGC50126vl_R AACAGGCAAGCTACAGAATGG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies