Top » Catalog » SNPs » Y20306

$18.00

Y20306
[Y20306]

Y20306
hg38 Position: ChrY:7105982..7105982
Ancestral: T
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: J2a
Comments: Below Y20307
Forward Primer: Y20306vl_F GGAAGAAGTAGGGGCTGGAC
Reverse Primer: Y20306vl_R TCCAGGTAAGTGGCCAAAG
Reviews

Customers who bought this product also purchased
Y20319
Y20319
Y20573
Y20573
Y20316
Y20316
Y20567
Y20567
J2a-Y20306 Segregation Panel
J2a-Y20306 Segregation Panel
Y20554
Y20554
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies