Top » Catalog » SNPs » Y20567

$18.00

Y20567
[Y20567]

Y20567
hg38 Position: ChrY:13244867..13244867
Ancestral: G
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: J2a
Comments: Below Y20307
Forward Primer: Y20567_F CCATATGGACTGGGATACTCAAC
Reverse Primer: Y20567_R GCTCCAGGACCATTTGTTTC
Reviews

Customers who bought this product also purchased
Y20575
Y20575
Y20316
Y20316
Y20573
Y20573
Y20306
Y20306
Y20554
Y20554
J2a-Y20306 Segregation Panel
J2a-Y20306 Segregation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies