Top » Catalog » SNPs » Y20575

$18.00

Y20575
[Y20575]

Y20575
hg38 Position: ChrY:19198560..19198560
Ancestral: C
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: J2a
Comments: Below Y20307
Forward Primer: Y20575v2_F GTTGCCTTGGCTGGACTG
Reverse Primer: Y20575v2_R CACAGCAGACAGCAAATATAGTGC
Reviews

Customers who bought this product also purchased
Y20316
Y20316
Y20567
Y20567
Y20306
Y20306
Y20554
Y20554
J2a-Y20306 Segregation Panel
J2a-Y20306 Segregation Panel
Y20325
Y20325
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY183734
1 x A1351
1 x BY68917
1 x BY171159
1 x A6172
1 x YP1478
1 x A15352
1 x YP4497
1 x YP1676
1 x Z35499.2
1 x FT402664
1 x YP3924
1 x FGC31158
1 x A1967
$252.00
Haplogroup Info
Other products
Currencies