Top » Catalog » SNPs » Y20575

$18.00

Y20575
[Y20575]

Y20575
hg38 Position: ChrY:19198560..19198560
Ancestral: C
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: J2a
Comments: Below Y20307
Forward Primer: Y20575v2_F GTTGCCTTGGCTGGACTG
Reverse Primer: Y20575v2_R CACAGCAGACAGCAAATATAGTGC
Reviews

Customers who bought this product also purchased
Y20319
Y20319
Y20573
Y20573
Y20316
Y20316
Y20567
Y20567
Y20306
Y20306
Y20554
Y20554
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies