Top » Catalog » SNPs » BZ134

$18.00

BZ134
[BZ134]

BZ134
hg38 Position: ChrY:13675654..13675654
Ancestral: G
Derived: C
Reference: Q Y-DNA Haplogroup project (2016)
ISOGG Haplogroup: Q
Comments: Y2209*
Forward Primer: BZ134_F TGAGCCTCAAACAGAGACAGG
Reverse Primer: BZ134_R CCAGAAAGAATGGCCTTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies