Top » Catalog » SNPs » FGC2012

$19.00

FGC2012
[FGC2012]

FGC2012
hg38 Position: ChrY:13450857..13450857
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: unknown
Comments: Aka YFS030356
Forward Primer: FGC2012_F AACACTTCAGGGGGCTGAG
Reverse Primer: FGC2012_R TGCTTGCCTCTCTTACATGG
Reviews

Customers who bought this product also purchased
FGC11
FGC11
ZS4349
ZS4349
FGC8223
FGC8223
FGC22316
FGC22316
M267
M267
ZS4360
ZS4360
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies