Top » Catalog » SNPs » FGC5511

$18.00

FGC5511
[FGC5511]

FGC5511
hg38 Position: ChrY:8047388..8047388
Ancestral: C
Derived: T
Reference: Full Genomes Inc (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1~
Comments: Found in a R-DF13 person
Forward Primer: FGC5511_F CACAAGAGAGTGGATGGTGACT
Reverse Primer: FGC5511_R AAATCACACAGGTCGTTGGG
Reviews

Customers who bought this product also purchased
FGC43417
FGC43417
YFS444718
YFS444718
Z39589
Z39589
A117
A117
PF5191
PF5191
FGC35401
FGC35401
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies